Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_position End_position Strand Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_file Sequencer Tumor_Sample_UUID Matched_Norm_Sample_UUID Genome_Change Annotation_Transcript Transcript_Strand Transcript_Exon Transcript_Position cDNA_Change Codon_Change Protein_Change Other_Transcripts Refseq_mRNA_Id Refseq_prot_Id SwissProt_acc_Id SwissProt_entry_Id Description UniProt_AApos UniProt_Region UniProt_Site UniProt_Natural_Variations UniProt_Experimental_Info GO_Biological_Process GO_Cellular_Component GO_Molecular_Function COSMIC_overlapping_mutations COSMIC_fusion_genes COSMIC_tissue_types_affected COSMIC_total_alterations_in_gene Tumorscape_Amplification_Peaks Tumorscape_Deletion_Peaks TCGAscape_Amplification_Peaks TCGAscape_Deletion_Peaks DrugBank ref_context gc_content CCLE_ONCOMAP_overlapping_mutations CCLE_ONCOMAP_total_mutations_in_gene CGC_Mutation_Type CGC_Translocation_Partner CGC_Tumor_Types_Somatic CGC_Tumor_Types_Germline CGC_Other_Diseases DNARepairGenes_Role FamilialCancerDatabase_Syndromes MUTSIG_Published_Results OREGANNO_ID OREGANNO_Values t_alt_count t_ref_count validation_status validation_method validation_tumor_sample validation_alt_allele pox qox isArtifactMode oxoGCut PAX7 5081 broad.mit.edu 37 1 19029673 19029673 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:19029673C>T uc001bay.2 + 7 1636 c.1038C>T c.(1036-1038)GCC>GCT p.A346A PAX7_uc001baz.2_Silent_p.A344A|PAX7_uc010oct.1_Silent_p.A346A NM_002584 NP_002575 P23759 PAX7_HUMAN paired box 7 isoform 1 346 Poly-Ala. anti-apoptosis nucleus protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity PAX7/FOXO1(197) soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1) 203 Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255) UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576) CTGCAGCCGCCGACACCAGCT 0.667 NA T FOXO1A alveolar rhabdomyosarcoma 4 16 0 0 0 0 TMEM39B 55116 broad.mit.edu 37 1 32542920 32542920 + Splice_Site SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:32542920G>A uc010ogv.1 + 5 736 c.590_splice c.e5+1 p.P197_splice TMEM39B_uc010ogt.1_Intron|TMEM39B_uc010ogu.1_Splice_Site_p.P70_splice|TMEM39B_uc001bue.3_Splice_Site_p.P197_splice|TMEM39B_uc001buf.3_Intron|TMEM39B_uc010ogw.1_Intron NM_018056 NP_060526 Q9GZU3 TM39B_HUMAN transmembrane protein 39B integral to membrane 0 Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174) TCTGCTATCCGTGAGTACCCC 0.597 NA 19 75 0 0 0 0 RIMKLA 284716 broad.mit.edu 37 1 42880192 42880192 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:42880192C>T uc001chi.2 + 5 861 c.723C>T c.(721-723)GGC>GGT p.G241G NM_173642 NP_775913 Q8IXN7 RIMKA_HUMAN ribosomal modification protein rimK-like family 241 ATP-grasp. protein modification process cytoplasm acid-amino acid ligase activity|ATP binding|metal ion binding 0 CAGAACAAGGCAAGCAGTTGG 0.502 NA 60 351 0 0 0 0 ELOVL1 64834 broad.mit.edu 37 1 43830980 43830980 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:43830980G>A uc001ciz.2 - 4 357 c.114C>T c.(112-114)TAC>TAT p.Y38Y ELOVL1_uc001cja.2_Silent_p.Y38Y|ELOVL1_uc001cjb.2_Silent_p.Y38Y|ELOVL1_uc001cjc.2_RNA|ELOVL1_uc010okh.1_Silent_p.Y38Y NM_022821 NP_073732 Q9BW60 ELOV1_HUMAN elongation of very long chain fatty acids-like 38 Helical; (Potential). fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|sphingolipid biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process integral to endoplasmic reticulum membrane fatty acid elongase activity|protein binding 0 all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155) Myeloproliferative disorder(586;0.0333) CGAAGTACACGTAGGTCAGGA 0.527 NA 14 40 0 0 0 0 LRRC8D 55144 broad.mit.edu 37 1 90400812 90400812 + Nonsense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:90400812C>T uc001dnm.2 + 3 2610 c.2185C>T c.(2185-2187)CAG>TAG p.Q729* LRRC8D_uc001dnn.2_Nonsense_Mutation_p.Q729* NM_001134479 NP_001127951 Q7L1W4 LRC8D_HUMAN leucine rich repeat containing 8 family, member 729 integral to membrane protein binding ovary(2) 2 all_lung(203;0.0894)|Lung NSC(277;0.227) all cancers(265;0.0109)|Epithelial(280;0.0427) ATTTAGTTTACAGAAACTCAG 0.378 NA 22 140 0 0 0 0 S100A7A 338324 broad.mit.edu 37 1 153390659 153390659 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:153390659C>T uc001fbt.1 + 2 158 c.101C>T c.(100-102)ACG>ATG p.T34M NM_176823 NP_789793 Q86SG5 S1A7A_HUMAN S100 calcium binding protein A7-like 1 34 EF-hand 1. cytoplasm calcium ion binding skin(1) 1 all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127) LUSC - Lung squamous cell carcinoma(543;0.171) AGCCTGCTGACGATGATGAAG 0.483 NA 81 190 0 0 0 0 FCRL5 83416 broad.mit.edu 37 1 157514262 157514262 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:157514262C>T uc001fqu.2 - 5 792 c.634G>A c.(634-636)GAG>AAG p.E212K FCRL5_uc009wsm.2_Missense_Mutation_p.E212K|FCRL5_uc010phv.1_Missense_Mutation_p.E212K|FCRL5_uc010phw.1_Missense_Mutation_p.E127K|FCRL5_uc001fqv.1_Missense_Mutation_p.E212K|FCRL5_uc010phx.1_5'UTR NM_031281 NP_112571 Q96RD9 FCRL5_HUMAN Fc receptor-like 5 212 Extracellular (Potential).|Ig-like C2-type 2. integral to membrane|plasma membrane receptor activity ovary(3)|breast(2)|central_nervous_system(1) 6 all_hematologic(112;0.0378)|Hepatocellular(266;0.178) Prostate(1639;0.231) AGCTGGGTCTCACAGGTCAGG 0.562 NA 57 238 0 0 0 0 CD1A 909 broad.mit.edu 37 1 158226598 158226598 + Silent SNP C C G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:158226598C>G uc001frt.2 + 4 1160 c.627C>G c.(625-627)TCC>TCG p.S209S NM_001763 NP_001754 P06126 CD1A_HUMAN CD1A antigen precursor 209 Extracellular (Potential).|Ig-like. antigen processing and presentation|immune response endosome membrane|integral to plasma membrane|MHC class I protein complex pancreas(2)|skin(1) 3 all_hematologic(112;0.0378) Antithymocyte globulin(DB00098) CCTGGCTGTCCCATGGCCCCA 0.522 NA 37 178 0 0 0 0 SPTA1 6708 broad.mit.edu 37 1 158615002 158615002 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:158615002G>A uc001fst.1 - 29 4369 c.4170C>T c.(4168-4170)ATC>ATT p.I1390I NM_003126 NP_003117 P02549 SPTA1_HUMAN spectrin, alpha, erythrocytic 1 1390 Spectrin 13. actin filament capping|actin filament organization|axon guidance|regulation of cell shape cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton actin filament binding|calcium ion binding|structural constituent of cytoskeleton ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1) 8 all_hematologic(112;0.0378) ACTGGTCTAGGATCTTCTTGC 0.438 NA 46 300 0 0 0 0 DDR2 4921 broad.mit.edu 37 1 162748507 162748507 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:162748507C>T uc001gcf.2 + 18 2886 c.2421C>T c.(2419-2421)GAC>GAT p.D807D DDR2_uc001gcg.2_Silent_p.D807D NM_001014796 NP_001014796 Q16832 DDR2_HUMAN discoidin domain receptor family, member 2 807 Cytoplasmic (Potential).|Protein kinase. cell adhesion integral to plasma membrane ATP binding|transmembrane receptor protein tyrosine kinase activity lung(2)|central_nervous_system(2)|ovary(1)|kidney(1) 6 all_hematologic(112;0.115) BRCA - Breast invasive adenocarcinoma(70;0.113) TCTTCCGAGACCAAGGGAGGC 0.498 NA 23 135 0 0 0 0 ILDR2 387597 broad.mit.edu 37 1 166905901 166905901 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:166905901C>T uc001gdx.1 - 5 686 c.630G>A c.(628-630)CAG>CAA p.Q210Q NM_199351 NP_955383 Q71H61 ILDR2_HUMAN immunoglobulin-like domain containing receptor 210 Cys-rich.|Cytoplasmic (Potential). integral to membrane ovary(1) 1 GAGGGCAGCACTGGCACCAGC 0.592 NA 9 68 0 0 0 0 FAIM3 9214 broad.mit.edu 37 1 207087230 207087230 + Missense_Mutation SNP G G A rs138817695 byFrequency TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:207087230G>A uc001hey.2 - 2 426 c.247C>T c.(247-249)CGC>TGC p.R83C FAIM3_uc010prz.1_Intron|FAIM3_uc010psa.1_Missense_Mutation_p.T26M|FAIM3_uc010psb.1_Missense_Mutation_p.R83C NM_005449 NP_005440 O60667 FAIM3_HUMAN Fas apoptotic inhibitory molecule 3 isoform a 83 Ig-like.|Extracellular (Potential). anti-apoptosis|cellular defense response integral to membrane central_nervous_system(1) 1 Breast(84;0.201) AGATTCTTGCGTGGGTATTGC 0.537 NA 27 220 0 0 0 0 ESRRG 2104 broad.mit.edu 37 1 216850620 216850620 + Missense_Mutation SNP G G C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:216850620G>C uc001hkw.1 - 2 436 c.270C>G c.(268-270)ATC>ATG p.I90M ESRRG_uc001hky.1_Missense_Mutation_p.I67M|ESRRG_uc009xdp.1_Missense_Mutation_p.I67M|ESRRG_uc001hkz.1_Missense_Mutation_p.I67M|ESRRG_uc010puc.1_Missense_Mutation_p.I67M|ESRRG_uc001hla.1_Missense_Mutation_p.I67M|ESRRG_uc001hlb.1_Missense_Mutation_p.I67M|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.I67M|ESRRG_uc001hld.1_Missense_Mutation_p.I67M|ESRRG_uc001hkx.1_Missense_Mutation_p.I95M|ESRRG_uc009xdo.1_Missense_Mutation_p.I67M|ESRRG_uc001hle.1_Missense_Mutation_p.I67M NM_001438 NP_001429 P62508 ERR3_HUMAN estrogen-related receptor gamma isoform 1 90 positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor nucleoplasm AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding ovary(1)|kidney(1) 2 OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713) Diethylstilbestrol(DB00255) TACCTCCCAGGATAGGAGCAG 0.537 NA 28 198 0 0 0 0 OR11L1 391189 broad.mit.edu 37 1 248004602 248004602 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:248004602G>A uc001idn.1 - 1 597 c.597C>T c.(595-597)ATC>ATT p.I199I NM_001001959 NP_001001959 Q8NGX0 O11L1_HUMAN olfactory receptor, family 11, subfamily L, 199 Helical; Name=5; (Potential). sensory perception of smell integral to membrane|plasma membrane olfactory receptor activity ovary(1)|pancreas(1)|skin(1) 3 all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858) OV - Ovarian serous cystadenocarcinoma(106;0.0319) ACAGGATGAAGATGGTCACCT 0.483 NA 29 180 0 0 0 0 TUBB8 347688 broad.mit.edu 37 10 94647 94647 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr10:94647C>T uc001ifi.2 - 3 185 c.185G>A c.(184-186)CGC>CAC p.R62H TUBB8_uc009xhe.2_Intron|TUBB8_uc010pzs.1_5'UTR NM_177987 NP_817124 Q3ZCM7 TBB8_HUMAN tubulin, beta 8 isoform 1 62 microtubule-based movement|protein polymerization cytoplasm|microtubule GTP binding|GTPase activity|structural molecule activity ovary(1) 1 all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235) Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132) GAGCACAGCGCGGGGCACGTA 0.697 NA 14 53 0 0 0 0 LRRC4C 57689 broad.mit.edu 37 11 40137559 40137559 + Missense_Mutation SNP C C A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr11:40137559C>A uc001mxa.1 - 2 2248 c.284G>T c.(283-285)AGC>ATC p.S95I LRRC4C_uc001mxc.1_Missense_Mutation_p.S91I|LRRC4C_uc001mxd.1_Missense_Mutation_p.S91I|LRRC4C_uc001mxb.1_Missense_Mutation_p.S91I NM_020929 NP_065980 Q9HCJ2 LRC4C_HUMAN netrin-G1 ligand precursor 95 LRR 1. regulation of axonogenesis integral to membrane protein binding ovary(4)|skin(3)|central_nervous_system(1) 8 all_lung(304;0.0575)|Lung NSC(402;0.138) GTGCTTGAAGCTGTTCACTTT 0.473 NA 32 90 7.73e-29 9.16e-29 1 0 OR5T3 390154 broad.mit.edu 37 11 56020434 56020434 + Missense_Mutation SNP G G T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr11:56020434G>T uc010rjd.1 + 1 759 c.759G>T c.(757-759)TTG>TTT p.L253F NM_001004747 NP_001004747 Q8NGG3 OR5T3_HUMAN olfactory receptor, family 5, subfamily T, 253 Cytoplasmic (Potential). sensory perception of smell integral to membrane|plasma membrane olfactory receptor activity 0 Esophageal squamous(21;0.00448) TCATTCTGTTGTCCATTCTGA 0.423 NA 58 380 6.18e-18 7.23e-18 1 0 MAP3K11 4296 broad.mit.edu 37 11 65380600 65380600 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr11:65380600C>T uc001oew.2 - 1 1121 c.628G>A c.(628-630)GTG>ATG p.V210M MAP3K11_uc010rol.1_5'Flank NM_002419 NP_002410 Q16584 M3K11_HUMAN mitogen-activated protein kinase kinase kinase 210 Protein kinase. activation of JUN kinase activity|cell proliferation|G1 phase of mitotic cell cycle|microtubule-based process|positive regulation of JNK cascade|protein autophosphorylation centrosome|microtubule ATP binding|JUN kinase kinase kinase activity|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity p.V210M(1) breast(3)|lung(1)|central_nervous_system(1)|skin(1) 6 TGGGGAGGCACGCGCCGCCCG 0.657 NA 14 72 0 0 0 0 ROBO3 64221 broad.mit.edu 37 11 124743756 124743756 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr11:124743756C>T uc001qbc.2 + 11 1974 c.1782C>T c.(1780-1782)TTC>TTT p.F594F ROBO3_uc010saq.1_5'Flank|ROBO3_uc001qbd.2_5'Flank|ROBO3_uc010sar.1_5'Flank|ROBO3_uc001qbe.2_5'Flank NM_022370 NP_071765 Q96MS0 ROBO3_HUMAN roundabout, axon guidance receptor, homolog 3 594 Fibronectin type-III 1.|Extracellular (Potential). axon midline choice point recognition integral to membrane receptor activity breast(1)|central_nervous_system(1) 2 all_hematologic(175;0.215) Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112) BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296) TAGAGGCCTTCAGGTATGGAG 0.498 NA 15 14 0 0 0 0 DDX47 51202 broad.mit.edu 37 12 12966313 12966313 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr12:12966313C>T uc001rav.2 + 4 610 c.12C>T c.(10-12)CCC>CCT p.P4P DDX47_uc009zhw.1_Silent_p.P4P|DDX47_uc001rax.2_Silent_p.P4P|DDX47_uc001ray.2_Silent_p.P4P|DDX47_uc010shn.1_Silent_p.P4P NM_016355 NP_057439 Q9H0S4 DDX47_HUMAN DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 4 nucleolus|nucleolus ATP binding|ATP-dependent helicase activity|protein binding|RNA binding 0 Prostate(47;0.0526) BRCA - Breast invasive adenocarcinoma(232;0.0354) TGGCGGCACCCGAGGAACACG 0.567 NA OREG0021680 type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip) 6 42 0 0 0 0 EMP1 2012 broad.mit.edu 37 12 13364446 13364446 + Missense_Mutation SNP T T A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr12:13364446T>A uc001rbr.2 + 2 249 c.2T>A c.(1-3)ATG>AAG p.M1K EMP1_uc009zhy.2_Intron|EMP1_uc010shr.1_Missense_Mutation_p.M1K NM_001423 NP_001414 P54849 EMP1_HUMAN epithelial membrane protein 1 1 Helical; (Potential). cell growth|cell proliferation|epidermis development integral to membrane|membrane fraction 0 Prostate(47;0.194) BRCA - Breast invasive adenocarcinoma(232;0.153) AGAGCCAACATGTTGGTATTG 0.373 NA 158 164 0 0 0 0 BICD1 636 broad.mit.edu 37 12 32260449 32260449 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr12:32260449C>T uc001rku.2 + 1 265 c.184C>T c.(184-186)CTC>TTC p.L62F BICD1_uc001rkv.2_Missense_Mutation_p.L62F|BICD1_uc010skd.1_RNA NM_001714 NP_001705 Q96G01 BICD1_HUMAN bicaudal D homolog 1 isoform 1 62 Potential. anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton large_intestine(1)|central_nervous_system(1) 2 all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204) OV - Ovarian serous cystadenocarcinoma(6;0.0201) GTACGACAGCCTCAAACAGGA 0.587 NA 9 9 0 0 0 0 DNM1L 10059 broad.mit.edu 37 12 32895604 32895604 + Silent SNP A A G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr12:32895604A>G uc001rld.2 + 19 2237 c.2076A>G c.(2074-2076)AAA>AAG p.K692K DNM1L_uc001rle.2_Silent_p.K666K|DNM1L_uc001rlf.2_Silent_p.K655K|DNM1L_uc010skh.1_Silent_p.K758K|DNM1L_uc001rlg.2_Silent_p.K747K|DNM1L_uc001rlh.2_Silent_p.K734K|DNM1L_uc010ski.1_Silent_p.K489K NM_012062 NP_036192 O00429 DNM1L_HUMAN dynamin 1-like isoform 1 692 GED. cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane GTP binding|GTPase activity|ubiquitin protein ligase binding ovary(1)|pancreas(1) 2 Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239) AGCTGTATAAATCATCCTTAT 0.408 NA 147 135 0 0 0 0 MYF5 4617 broad.mit.edu 37 12 81112691 81112691 + Missense_Mutation SNP T T C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr12:81112691T>C uc001szg.2 + 3 764 c.629T>C c.(628-630)ATA>ACA p.I210T NM_005593 NP_005584 P13349 MYF5_HUMAN myogenic factor 5 210 muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development nucleoplasm DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity ovary(1) 1 TTATCCAACATAGTGGACCGG 0.458 NA 38 115 0 0 0 0 RHOF 54509 broad.mit.edu 37 12 122219075 122219075 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr12:122219075G>A uc001ubb.2 - 3 305 c.250C>T c.(250-252)CGG>TGG p.R84W TMEM120B_uc001ubc.3_3'UTR|TMEM120B_uc009zxh.2_3'UTR|TMEM120B_uc001uba.1_Intron|RHOF_uc001ubd.3_Missense_Mutation_p.R84W NM_019034 NP_061907 Q9HBH0 RHOF_HUMAN ras homolog gene family, member F precursor 84 actin filament organization|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction cytoskeleton|cytosol|plasma membrane GTP binding|GTPase activity ovary(1) 1 all_neural(191;0.0684)|Medulloblastoma(191;0.0922) OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223) GACAGGGGCCGCAGCCGGTCA 0.617 NA 10 65 0 0 0 0 WDR66 144406 broad.mit.edu 37 12 122413558 122413558 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr12:122413558G>A uc009zxk.2 + 19 3115 c.2973G>A c.(2971-2973)ATG>ATA p.M991I NM_144668 NP_653269 Q8TBY9 WDR66_HUMAN WD repeat domain 66 991 calcium ion binding ovary(1)|skin(1) 2 all_neural(191;0.0496)|Medulloblastoma(191;0.0922) OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248) CTTTTGTCATGAGAGCAATTG 0.443 NA 15 102 0 0 0 0 ATP8A2 51761 broad.mit.edu 37 13 26273327 26273327 + Missense_Mutation SNP T T G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr13:26273327T>G uc001uqk.2 + 25 2370 c.2228T>G c.(2227-2229)ATT>AGT p.I743S ATP8A2_uc010tdi.1_Missense_Mutation_p.I703S|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.I293S NM_016529 NP_057613 Q9NTI2 AT8A2_HUMAN ATPase, aminophospholipid transporter-like, 703 Cytoplasmic (Potential). ATP biosynthetic process|negative regulation of cell proliferation integral to membrane ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity ovary(2)|large_intestine(1)|skin(1) 4 Breast(139;0.0201)|Lung SC(185;0.0225) all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079) AGGGCAGCCATTACTCAGCAC 0.428 NA 11 101 0 0 0 0 PCDH20 64881 broad.mit.edu 37 13 61986457 61986457 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr13:61986457G>A uc001vid.3 - 2 2139 c.1775C>T c.(1774-1776)ACA>ATA p.T592I PCDH20_uc010thj.1_Missense_Mutation_p.T592I NM_022843 NP_073754 Q8N6Y1 PCD20_HUMAN protocadherin 20 565 Extracellular (Potential).|Cadherin 4. homophilic cell adhesion integral to membrane|plasma membrane calcium ion binding ovary(4)|breast(1)|central_nervous_system(1) 6 Breast(118;0.195)|Prostate(109;0.229) GBM - Glioblastoma multiforme(99;0.000118) AGTAGAAACTGTCAGAATTCC 0.473 NA 22 213 0 0 0 0 LMO7 4008 broad.mit.edu 37 13 76391321 76391321 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr13:76391321C>T uc001vjv.2 + 9 2032 c.1272C>T c.(1270-1272)AGC>AGT p.S424S LMO7_uc010thv.1_Silent_p.S375S|LMO7_uc001vjt.1_Silent_p.S323S|LMO7_uc010thw.1_Silent_p.S274S|LMO7_uc001vjw.1_Silent_p.S330S NM_015842 NP_056667 Q8WWI1 LMO7_HUMAN LIM domain only 7 isoform 2 709 cytoplasm|nucleus|ubiquitin ligase complex ubiquitin-protein ligase activity|zinc ion binding large_intestine(2)|ovary(1)|prostate(1)|skin(1) 5 Breast(118;0.0992) GBM - Glioblastoma multiforme(99;0.0109) GTGATGTCAGCGCAGAAGATG 0.408 NA 30 112 0 0 0 0 MDGA2 161357 broad.mit.edu 37 14 47426843 47426843 + Missense_Mutation SNP G G C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr14:47426843G>C uc001wwj.3 - 9 1812 c.1616C>G c.(1615-1617)CCC>CGC p.P539R MDGA2_uc001wwi.3_Missense_Mutation_p.P310R|MDGA2_uc010ani.2_Missense_Mutation_p.P99R NM_001113498 NP_001106970 Q7Z553 MDGA2_HUMAN MAM domain containing 1 isoform 1 539 spinal cord motor neuron differentiation anchored to membrane|plasma membrane ovary(4)|large_intestine(1)|pancreas(1) 6 CACTGCAGGGGGATCTGTAGA 0.438 NA 18 128 0 0 0 0 TRIP11 9321 broad.mit.edu 37 14 92472287 92472287 + Missense_Mutation SNP T T A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr14:92472287T>A uc001xzy.2 - 11 2821 c.2033A>T c.(2032-2034)GAA>GTA p.E678V TRIP11_uc010auf.1_Missense_Mutation_p.E414V NM_004239 NP_004230 Q15643 TRIPB_HUMAN thyroid hormone receptor interactor 11 678 Potential. transcription from RNA polymerase II promoter cytoskeleton|Golgi apparatus|membrane|nucleus protein binding|transcription coactivator activity ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1) 13 COAD - Colon adenocarcinoma(157;0.223) CTTTTCATTTTCCATTTTGAC 0.318 NA T PDGFRB AML 21 128 0 0 0 0 KIAA0284 283638 broad.mit.edu 37 14 105359860 105359860 + Missense_Mutation SNP C C G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr14:105359860C>G uc010axb.2 + 15 4263 c.4039C>G c.(4039-4041)CTG>GTG p.L1347V INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Missense_Mutation_p.L1277V|KIAA0284_uc001yps.2_Missense_Mutation_p.L1288V|KIAA0284_uc001ypt.2_Missense_Mutation_p.L15V NM_001112726 NP_001106197 Q9Y4F5 K0284_HUMAN hypothetical protein LOC283638 isoform 1 1382 cytoplasm|microtubule breast(1) 1 all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183) all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116) Epithelial(152;0.178) CCTCTTGCAGCTGGTGCAGCG 0.672 NA 2 1 0 0 0 0 CRTC3 64784 broad.mit.edu 37 15 91181740 91181740 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr15:91181740G>A uc002bpp.2 + 12 1435 c.1329G>A c.(1327-1329)TCG>TCA p.S443S CRTC3_uc002bpo.2_Silent_p.S443S NM_022769 NP_073606 Q6UUV7 CRTC3_HUMAN transducer of regulated CREB protein 3 isoform 443 interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent cytoplasm|nucleus CRTC3/MAML2(26) salivary_gland(26)|ovary(1) 27 Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163) BRCA - Breast invasive adenocarcinoma(143;0.0745) CCCAGGTGTCGCCGCCACCCC 0.632 NA T MAML2 salivary gland mucoepidermoid 14 93 0 0 0 0 CHD2 1106 broad.mit.edu 37 15 93510590 93510590 + Missense_Mutation SNP G G T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr15:93510590G>T uc002bsp.2 + 17 2611 c.2036G>T c.(2035-2037)GGG>GTG p.G679V CHD2_uc002bso.1_Missense_Mutation_p.G679V NM_001271 NP_001262 O14647 CHD2_HUMAN chromodomain helicase DNA binding protein 2 679 regulation of transcription from RNA polymerase II promoter nucleus ATP binding|ATP-dependent DNA helicase activity|DNA binding ovary(1)|skin(1) 2 Lung NSC(78;0.00976)|all_lung(78;0.016) BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814) GAAGACCATGGGAAGGGGAGA 0.398 NA 11 72 1.5e-05 1.64e-05 1 0 PRSS36 146547 broad.mit.edu 37 16 31154165 31154165 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr16:31154165C>T uc002ebd.2 - 9 1309 c.1250G>A c.(1249-1251)CGC>CAC p.R417H PRSS36_uc010vff.1_Missense_Mutation_p.R192H|PRSS36_uc010vfg.1_Missense_Mutation_p.R417H|PRSS36_uc010vfh.1_Missense_Mutation_p.R417H NM_173502 NP_775773 Q5K4E3 POLS2_HUMAN protease, serine, 36 precursor 417 Peptidase S1 2. proteolysis cytoplasm|proteinaceous extracellular matrix serine-type endopeptidase activity ovary(1) 1 CACGGGCGTGCGCAGCTGCAG 0.751 NA 6 18 0 0 0 0 ADCY7 113 broad.mit.edu 37 16 50339755 50339755 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr16:50339755C>T uc002egd.1 + 13 2015 c.1747C>T c.(1747-1749)CGC>TGC p.R583C ADCY7_uc002egc.1_Missense_Mutation_p.R583C NM_001114 NP_001105 P51828 ADCY7_HUMAN adenylate cyclase 7 583 Cytoplasmic (Potential). activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport integral to membrane|plasma membrane adenylate cyclase activity|ATP binding|metal ion binding skin(1) 1 all_cancers(37;0.0127) GBM - Glioblastoma multiforme(240;0.195) Bromocriptine(DB01200) GGGCTTTGAGCGCGAGGTGAG 0.677 NA 9 53 0 0 0 0 DPEP3 64180 broad.mit.edu 37 16 68011603 68011603 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr16:68011603C>T uc002evc.3 - 6 1055 c.961G>A c.(961-963)GTG>ATG p.V321M DPEP3_uc010cex.2_Missense_Mutation_p.V321M NM_022357 NP_071752 Q9H4B8 DPEP3_HUMAN dipeptidase 3 isoform a 296 meiosis anchored to membrane dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity breast(3) 3 Ovarian(137;0.192) OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236) TTGTCACACACAGCTCTGGCA 0.483 NA 9 36 0 0 0 0 PLCG2 5336 broad.mit.edu 37 16 81927341 81927341 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr16:81927341C>T uc002fgt.2 + 12 1166 c.1014C>T c.(1012-1014)AGC>AGT p.S338S PLCG2_uc010chg.1_Silent_p.S338S NM_002661 NP_002652 P16885 PLCG2_HUMAN phospholipase C, gamma 2 338 PI-PLC X-box. intracellular signal transduction|phospholipid catabolic process|platelet activation plasma membrane phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity large_intestine(4)|lung(2)|ovary(1)|skin(1) 8 AGCTGCGGAGCGAGTCGTCCC 0.617 NA 11 78 0 0 0 0 TP53 7157 broad.mit.edu 37 17 7578265 7578265 + Missense_Mutation SNP A A G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr17:7578265A>G uc002gim.2 - 6 778 c.584T>C c.(583-585)ATC>ACC p.I195T TP53_uc002gig.1_Missense_Mutation_p.I195T|TP53_uc002gih.2_Missense_Mutation_p.I195T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I63T|TP53_uc010cng.1_Missense_Mutation_p.I63T|TP53_uc002gii.1_Missense_Mutation_p.I63T|TP53_uc010cnh.1_Missense_Mutation_p.I195T|TP53_uc010cni.1_Missense_Mutation_p.I195T|TP53_uc002gij.2_Missense_Mutation_p.I195T|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.I102T|TP53_uc002gio.2_Missense_Mutation_p.I63T|TP53_uc010vug.1_Missense_Mutation_p.I156T NM_001126112 NP_001119584 P04637 P53_HUMAN tumor protein p53 isoform a 195 Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity). I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|I -> N (in sporadic cancers; somatic mutation). activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding p.I195T(61)|p.I195F(16)|p.I195N(12)|p.0?(7)|p.I195S(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*14(3)|p.I195fs*52(3)|p.K164_P219del(1)|p.I195L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.I195fs*12(1) large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1) 22245 all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081) GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174) TTCCACTCGGATAAGATGCTG 0.552 111 Mis|N|F breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types Other_conserved_DNA_damage_response_genes Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019) 25 50 0 0 0 0 ARSG 22901 broad.mit.edu 37 17 66366598 66366598 + Silent SNP G G A rs149931351 by1000genomes TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr17:66366598G>A uc002jhc.2 + 8 1711 c.915G>A c.(913-915)CCG>CCA p.P305P ARSG_uc002jhb.1_Silent_p.P141P NM_014960 NP_055775 Q96EG1 ARSG_HUMAN Arylsulfatase G precursor 305 sulfur compound metabolic process endoplasmic reticulum|extracellular space|lysosome arylsulfatase activity|metal ion binding ovary(1) 1 BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24) ACAATGGCCCGTGGGCTCAGA 0.552 NA 10 61 0 0 0 0 CASKIN2 57513 broad.mit.edu 37 17 73497569 73497569 + Missense_Mutation SNP A A C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr17:73497569A>C uc002joc.2 - 19 4048 c.3498T>G c.(3496-3498)ATT>ATG p.I1166M CASKIN2_uc010wsc.1_Missense_Mutation_p.I1084M NM_020753 NP_065804 Q8WXE0 CSKI2_HUMAN cask-interacting protein 2 isoform a 1166 cytoplasm pancreas(1) 1 all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246) all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154) CCTTGGTGCCAATGCTCTTCT 0.647 NA 24 146 0 0 0 0 CEP192 55125 broad.mit.edu 37 18 13056573 13056573 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr18:13056573C>T uc010xac.1 + 19 4064 c.3984C>T c.(3982-3984)CTC>CTT p.L1328L CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Silent_p.L853L|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_5'UTR|CEP192_uc002krs.1_Silent_p.L1069L NM_032142 NP_115518 E9PF99 E9PF99_HUMAN centrosomal protein 192kDa 1328 ovary(4)|pancreas(1) 5 CCTCTTCCCTCTGTAACCCAT 0.468 NA 36 218 0 0 0 0 POTEC 388468 broad.mit.edu 37 18 14542737 14542737 + Nonsense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr18:14542737G>A uc010dln.2 - 1 863 c.409C>T c.(409-411)CGA>TGA p.R137* POTEC_uc010xaj.1_RNA NM_001137671 NP_001131143 B2RU33 POTEC_HUMAN ANKRD26-like family B, member 2 137 skin(3) 3 AGATCTTCTCGACGGACGTGG 0.602 NA 28 159 0 0 0 0 ZNF414 84330 broad.mit.edu 37 19 8577310 8577310 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr19:8577310G>A uc002mkf.2 - 4 609 c.491C>T c.(490-492)GCT>GTT p.A164V ZNF414_uc002mke.3_Missense_Mutation_p.A164V|ZNF414_uc010dwf.2_Missense_Mutation_p.A153V NM_032370 NP_115746 Q96IQ9 ZN414_HUMAN zinc finger protein 414 isoform 2 164 C2H2-type 2. regulation of transcription, DNA-dependent|transcription, DNA-dependent nucleus DNA binding|zinc ion binding 0 TTTGCTGTGAGCCACCAGCTC 0.587 NA 36 96 0 0 0 0 CCDC97 90324 broad.mit.edu 37 19 41825480 41825480 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr19:41825480G>A uc002oqg.2 + 3 626 c.504G>A c.(502-504)GGG>GGA p.G168G CYP2F1_uc010xvw.1_Intron NM_052848 NP_443080 Q96F63 CCD97_HUMAN coiled-coil domain containing 97 168 0 TCTGTGCAGGGGGCGAGTACT 0.572 NA 23 176 0 0 0 0 TPRX1 284355 broad.mit.edu 37 19 48305393 48305393 + Missense_Mutation SNP C C A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr19:48305393C>A uc002php.1 - 2 946 c.875G>T c.(874-876)CGG>CTG p.R292L NM_198479 NP_940881 Q8N7U7 TPRX1_HUMAN tetra-peptide repeat homeobox 292 Gly-rich. nucleus sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity 0 all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133) OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048) GCTTCGCATCCGGCCAGGACT 0.383 NA 37 53 6.97e-18 8.13e-18 1 0 NTSR2 23620 broad.mit.edu 37 2 11802234 11802234 + Missense_Mutation SNP G G A rs148798482 byFrequency TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:11802234G>A uc002rbq.3 - 2 831 c.757C>T c.(757-759)CGC>TGC p.R253C NM_012344 NP_036476 O95665 NTR2_HUMAN neurotensin receptor 2 253 Cytoplasmic (Potential). sensory perception integral to plasma membrane 0 all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155) Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24) Levocabastine(DB01106) AGCTCCAGGCGGCTGGGGGTG 0.597 NA 51 153 0 0 0 0 ADCY3 109 broad.mit.edu 37 2 25059788 25059788 + Nonsense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:25059788G>A uc002rfs.3 - 8 1859 c.1660C>T c.(1660-1662)CAG>TAG p.Q554* ADCY3_uc002rfr.3_Nonsense_Mutation_p.Q187*|ADCY3_uc010ykm.1_Nonsense_Mutation_p.Q554* NM_004036 NP_004027 O60266 ADCY3_HUMAN adenylate cyclase 3 554 Cytoplasmic (Potential). activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport cytoplasm|integral to plasma membrane ATP binding|calmodulin binding|metal ion binding breast(3)|ovary(1) 4 Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203) GCACATACCTGGGCATCCTGC 0.522 NA 9 78 0 0 0 0 DNAJC27 51277 broad.mit.edu 37 2 25170613 25170613 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:25170613C>T uc002rft.1 - 7 745 c.694G>A c.(694-696)GAA>AAA p.E232K DNAJC27_uc010ykn.1_Missense_Mutation_p.E161K|DNAJC27_uc002rfu.1_RNA|DNAJC27_uc010eyg.1_Silent_p.*178* NM_016544 NP_057628 Q9NZQ0 DJC27_HUMAN DnaJ (Hsp40) homolog, subfamily C, member 27 232 J. protein folding|small GTPase mediated signal transduction GTP binding|heat shock protein binding|unfolded protein binding skin(1) 1 TTATTGACTTCATCCCTGGGA 0.453 NA 21 100 0 0 0 0 TTC7A 57217 broad.mit.edu 37 2 47278895 47278895 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:47278895G>A uc002rvo.2 + 18 2396 c.2028G>A c.(2026-2028)CGG>CGA p.R676R TTC7A_uc002rvm.2_Silent_p.R642R|TTC7A_uc010fbb.2_Silent_p.R700R|TTC7A_uc010fbc.2_Silent_p.R322R|TTC7A_uc002rvp.2_Silent_p.R557R|TTC7A_uc002rvq.2_Silent_p.R416R|TTC7A_uc002rvr.2_Silent_p.R125R NM_020458 NP_065191 Q9ULT0 TTC7A_HUMAN tetratricopeptide repeat domain 7A 676 binding breast(1)|skin(1) 2 all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18) Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114) GCTCCCGGCGGGCTTCGTCCA 0.667 NA 17 105 0 0 0 0 STON1-GTF2A1L 286749 broad.mit.edu 37 2 48809175 48809175 + Missense_Mutation SNP A A T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:48809175A>T uc010yol.1 + 1 1450 c.1403A>T c.(1402-1404)GAA>GTA p.E468V STON1_uc002rwo.3_Missense_Mutation_p.E468V|STON1_uc010fbm.2_Missense_Mutation_p.E468V|STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.E468V|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Missense_Mutation_p.E468V NM_006873 NP_006864 B7ZL16 B7ZL16_HUMAN stonin 1 468 endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter clathrin adaptor complex|transcription factor TFIIA complex ovary(3)|pancreas(1)|skin(1) 5 all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176) Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151) AAGCGAGATGAATCCTATTAT 0.373 NA 32 197 0 0 0 0 MYO7B 4648 broad.mit.edu 37 2 128387389 128387389 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:128387389G>A uc002top.2 + 34 4769 c.4716G>A c.(4714-4716)TCG>TCA p.S1572S MYO7B_uc002tor.1_Silent_p.S425S NM_001080527 NP_001073996 Q6PIF6 MYO7B_HUMAN myosin VIIB 1572 apical plasma membrane|myosin complex actin binding|ATP binding|motor activity ovary(1)|pancreas(1) 2 Colorectal(110;0.1) BRCA - Breast invasive adenocarcinoma(221;0.0753) CTAAGCCCTCGGCACAGCTGC 0.642 NA 9 43 0 0 0 0 XIRP2 129446 broad.mit.edu 37 2 168105922 168105922 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:168105922G>A uc002udx.2 + 8 8038 c.8020G>A c.(8020-8022)GAA>AAA p.E2674K XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E2499K|XIRP2_uc010fpq.2_Missense_Mutation_p.E2452K|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.E20K NM_152381 NP_689594 A4UGR9 XIRP2_HUMAN xin actin-binding repeat containing 2 isoform 1 2499 actin cytoskeleton organization cell junction actin binding skin(7)|ovary(6)|pancreas(1) 14 ATCAGCTTGCGAAATTAAACA 0.398 NA 38 121 0 0 0 0 TTN 7273 broad.mit.edu 37 2 179435824 179435824 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:179435824C>T uc010zfg.1 - 275 67555 c.67331G>A c.(67330-67332)CGG>CAG p.R22444Q uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R16139Q|TTN_uc010zfi.1_Missense_Mutation_p.R16072Q|TTN_uc010zfj.1_Missense_Mutation_p.R15947Q NM_133378 NP_596869 Q8WZ42 TITIN_HUMAN titin isoform N2-A 23371 ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1) 153 OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134) TGCCTCTGGCCGTCCTGGTGG 0.463 NA 41 256 0 0 0 0 CXCR2 3579 broad.mit.edu 37 2 219000234 219000234 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:219000234C>T uc002vgz.1 + 4 935 c.710C>T c.(709-711)ACG>ATG p.T237M CXCR2_uc002vha.1_Missense_Mutation_p.T237M|CXCR2_uc002vhb.1_Missense_Mutation_p.T237M NM_001557 NP_001548 P25025 CXCR2_HUMAN interleukin 8 receptor beta 237 Cytoplasmic (Potential). activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation cell surface|integral to plasma membrane|mast cell granule interleukin-8 receptor activity lung(1)|breast(1) 2 ACCCTGCGTACGCTGTTTAAG 0.577 NA 54 312 0 0 0 0 ANKZF1 55139 broad.mit.edu 37 2 220098637 220098637 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr2:220098637C>T uc002vkg.2 + 8 1194 c.1020C>T c.(1018-1020)CTC>CTT p.L340L ANKZF1_uc010zkv.1_Silent_p.L284L|ANKZF1_uc010zkw.1_Silent_p.L130L|ANKZF1_uc002vkh.2_Silent_p.L130L|ANKZF1_uc002vki.2_Silent_p.L340L|ANKZF1_uc002vkj.1_Silent_p.L328L NM_018089 NP_060559 Q9H8Y5 ANKZ1_HUMAN ankyrin repeat and zinc finger domain containing 340 intracellular zinc ion binding ovary(2) 2 Renal(207;0.0474) Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942) AGCGTGTGCTCCATAAGCTGA 0.557 NA 12 61 0 0 0 0 PTPRT 11122 broad.mit.edu 37 20 40713412 40713412 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr20:40713412G>A uc002xkg.2 - 29 4230 c.4046C>T c.(4045-4047)TCC>TTC p.S1349F PTPRT_uc010ggj.2_Missense_Mutation_p.S1368F|PTPRT_uc010ggi.2_Missense_Mutation_p.S552F NM_007050 NP_008981 O14522 PTPRT_HUMAN protein tyrosine phosphatase, receptor type, T 1349 Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2. homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway cell surface|integral to membrane|plasma membrane alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity skin(8)|ovary(7)|lung(5) 20 Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783) AGAGCGCTTGGAGGGGGGCGT 0.587 NA 11 37 0 0 0 0 CEBPB 1051 broad.mit.edu 37 20 48807602 48807602 + Missense_Mutation SNP G G C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr20:48807602G>C uc002xvi.1 + 1 227 c.32G>C c.(31-33)TGT>TCT p.C11S CEBPB_uc002xvh.2_RNA NM_005194 NP_005185 P17676 CEBPB_HUMAN CCAAT/enhancer binding protein beta 11 Required for Lys-174 sumoylation. acute-phase response|immune response sequence-specific enhancer binding RNA polymerase II transcription factor activity 0 BRCA - Breast invasive adenocarcinoma(9;5.72e-08)|STAD - Stomach adenocarcinoma(23;0.19) GACCCAGCATGTCTCCCCCTG 0.701 NA 4 8 0 0 0 0 CDH26 60437 broad.mit.edu 37 20 58587740 58587740 + Silent SNP G G A rs141182679 TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr20:58587740G>A uc002ybe.2 + 18 2754 c.2454G>A c.(2452-2454)GCG>GCA p.A818A CDH26_uc002ybf.1_Intron|CDH26_uc010zzy.1_RNA|CDH26_uc002ybg.2_Silent_p.A309A|CDH26_uc002ybh.2_Silent_p.A151A|CDH26_uc002ybi.2_Silent_p.A110A NM_177980 NP_817089 Q8IXH8 CAD26_HUMAN cadherin-like 26 isoform a Error:Variant_position_missing_in_Q8IXH8_after_alignment homophilic cell adhesion integral to membrane|plasma membrane calcium ion binding ovary(3)|central_nervous_system(1) 4 all_lung(29;0.00963) BRCA - Breast invasive adenocarcinoma(7;5.58e-09) GTTCAAAAGCGACTCCGTTTG 0.458 NA 36 110 0 0 0 0 KRTAP10-10 353333 broad.mit.edu 37 21 46057890 46057890 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr21:46057890C>T uc002zfq.2 + 1 618 c.556C>T c.(556-558)CCC>TCC p.P186S C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron NM_181688 NP_859016 P60014 KR10A_HUMAN keratin associated protein 10-10 186 15 X 5 AA repeats of C-C-X(3).|13. keratin filament 0 CTGCTGCAGACCCTCCTCCTC 0.652 NA 40 162 0 0 0 0 UBE2L3 7332 broad.mit.edu 37 22 21975875 21975875 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr22:21975875G>A uc002zva.1 + 4 459 c.382G>A c.(382-384)GAA>AAA p.E128K UBE2L3_uc011aig.1_Missense_Mutation_p.E96K|UBE2L3_uc002zuz.1_3'UTR|UBE2L3_uc010gti.1_RNA NM_003347 NP_003338 P68036 UB2L3_HUMAN ubiquitin-conjugating enzyme E2L 3 128 cell proliferation|cellular response to glucocorticoid stimulus|protein K11-linked ubiquitination|regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process cytoplasm|nucleus|ubiquitin ligase complex ATP binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity 0 Colorectal(54;0.105) CCTAGCTGAAGAATACTCTAA 0.488 NA 9 45 0 0 0 0 EFCAB6 64800 broad.mit.edu 37 22 43985982 43985982 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr22:43985982C>T uc003bdy.1 - 24 3219 c.3004G>A c.(3004-3006)GAA>AAA p.E1002K EFCAB6_uc003bdz.1_Missense_Mutation_p.E850K|EFCAB6_uc010gzi.1_Missense_Mutation_p.E850K|EFCAB6_uc010gzj.1_Missense_Mutation_p.E228K NM_022785 NP_073622 Q5THR3 EFCB6_HUMAN CAP-binding protein complex interacting protein 1002 regulation of transcription, DNA-dependent|transcription, DNA-dependent nucleus calcium ion binding ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1) 7 Ovarian(80;0.0247)|all_neural(38;0.025) AGCTCCCCTTCGGTAAGAGAA 0.408 NA 84 99 0 0 0 0 CNTN4 152330 broad.mit.edu 37 3 2924854 2924854 + Missense_Mutation SNP A A T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:2924854A>T uc003bpc.2 + 8 899 c.678A>T c.(676-678)AAA>AAT p.K226N CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Missense_Mutation_p.K226N NM_175607 NP_783200 Q8IWV2 CNTN4_HUMAN contactin 4 isoform a precursor 226 Ig-like C2-type 3. axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity anchored to membrane|axon|extracellular region|plasma membrane protein binding large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1) 7 Ovarian(110;0.156) Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01) ATGAGCCCAAAATAGAAGTGC 0.383 NA 9 40 0 0 0 0 TTC21A 199223 broad.mit.edu 37 3 39170768 39170768 + Missense_Mutation SNP T T G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:39170768T>G uc003cjc.2 + 15 2300 c.2123T>G c.(2122-2124)CTC>CGC p.L708R TTC21A_uc003cje.2_Missense_Mutation_p.L709R|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.L660R NM_145755 NP_665698 Q8NDW8 TT21A_HUMAN tetratricopeptide repeat domain 21A isoform 2 708 binding ovary(1) 1 KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738) CTGCAGACCCTCAGAGACAGG 0.517 NA 24 157 0 0 0 0 BSN 8927 broad.mit.edu 37 3 49691010 49691010 + Missense_Mutation SNP C C T rs142305207 TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:49691010C>T uc003cxe.3 + 5 4135 c.4021C>T c.(4021-4023)CGT>TGT p.R1341C NM_003458 NP_003449 Q9UPA5 BSN_HUMAN bassoon protein 1341 synaptic transmission cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome metal ion binding ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1) 8 BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336) TCCCGATGTCCGTGTCACTCA 0.612 NA 50 90 0 0 0 0 ITIH3 3699 broad.mit.edu 37 3 52841096 52841096 + Missense_Mutation SNP G G C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:52841096G>C uc003dfv.2 + 19 2272 c.2236G>C c.(2236-2238)GAC>CAC p.D746H ITIH3_uc011bek.1_Missense_Mutation_p.D554H NM_002217 NP_002208 Q06033 ITIH3_HUMAN inter-alpha (globulin) inhibitor H3 746 hyaluronan metabolic process extracellular region serine-type endopeptidase inhibitor activity ovary(2)|liver(1) 3 BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496) CAGCTGGCTGGACACAGTCAC 0.418 NA 3 12 0 0 0 0 CD200R1L 344807 broad.mit.edu 37 3 112548233 112548233 + Splice_Site SNP T T C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:112548233T>C uc003dzi.1 - 2 273 c.47_splice c.e2-1 p.A16_splice CD200R1L_uc011bhw.1_Splice_Site|CD200R1L_uc010hqf.1_Splice_Site NM_001008784 NP_001008784 Q6Q8B3 MO2R2_HUMAN CD200 cell surface glycoprotein receptor 2 integral to membrane receptor activity ovary(1) 1 TACTTGAAGCTAGAAAACATT 0.373 NA 31 75 0 0 0 0 KALRN 8997 broad.mit.edu 37 3 124418822 124418822 + Missense_Mutation SNP C C A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:124418822C>A uc003ehg.2 + 56 8065 c.7938C>A c.(7936-7938)AAC>AAA p.N2646K KALRN_uc003ehk.2_Missense_Mutation_p.N949K NM_001024660 NP_001019831 O60229 KALRN_HUMAN kalirin, RhoGEF kinase isoform 1 2645 Fibronectin type-III. apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport actin cytoskeleton|cytosol ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1) 6 GTGCCAGTAACCCCTGGGGAA 0.582 NA 73 238 1.52e-38 1.81e-38 1 0 EIF2A 83939 broad.mit.edu 37 3 150289839 150289839 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:150289839C>T uc003eya.2 + 10 922 c.906C>T c.(904-906)TTC>TTT p.F302F SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Silent_p.F175F|EIF2A_uc003eyc.2_Silent_p.F175F|EIF2A_uc011bnv.1_Silent_p.F277F|EIF2A_uc011bnw.1_Silent_p.F241F|EIF2A_uc003eyd.2_Silent_p.F77F|uc003eye.1_Intron NM_032025 NP_114414 Q9BY44 EIF2A_HUMAN eukaryotic translation initiation factor 2A 302 regulation of translation|ribosome assembly eukaryotic translation initiation factor 2 complex ribosome binding|translation initiation factor activity|tRNA binding 0 Melanoma(1037;0.0575) LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066) CGACAATTTTCAACTTGAAAT 0.378 NA 12 68 0 0 0 0 DRD5 1816 broad.mit.edu 37 4 9783799 9783799 + Missense_Mutation SNP T T A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr4:9783799T>A uc003gmb.3 + 1 542 c.146T>A c.(145-147)CTA>CAA p.L49Q NM_000798 NP_000789 P21918 DRD5_HUMAN dopamine receptor D5 49 Helical; Name=1; (Potential). activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic integral to plasma membrane skin(1) 1 Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624) CTGCTGACCCTACTCATCATC 0.677 NA 7 23 0 0 0 0 MUC7 4589 broad.mit.edu 37 4 71346528 71346528 + Nonsense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr4:71346528C>T uc011cat.1 + 4 355 c.67C>T c.(67-69)CGA>TGA p.R23* MUC7_uc011cau.1_Nonsense_Mutation_p.R23*|MUC7_uc003hfj.2_Nonsense_Mutation_p.R23* NM_001145006 NP_001138478 Q8TAX7 MUC7_HUMAN mucin 7, secreted precursor 23 extracellular region protein binding ovary(2)|central_nervous_system(1)|skin(1) 4 Lung(101;0.211) CAGTGAAGGTCGAGAAAGGGA 0.249 NA 20 162 0 0 0 0 BTF3 689 broad.mit.edu 37 5 72798376 72798376 + Missense_Mutation SNP C C G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr5:72798376C>G uc003kcr.1 + 3 508 c.265C>G c.(265-267)CAG>GAG p.Q89E BTF3_uc003kcq.1_Missense_Mutation_p.Q45E|BTF3_uc003kcs.1_RNA|BTF3_uc003kct.1_RNA NM_001037637 NP_001032726 P20290 BTF3_HUMAN basic transcription factor 3 isoform A 89 NAC-A/B. Missing (in Ref. 2; AAA58398). regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter nucleus protein binding 0 Lung NSC(167;0.00405)|Ovarian(174;0.0175) OV - Ovarian serous cystadenocarcinoma(47;2.73e-54) CAAAAAACTTCAGTTCTCCTT 0.383 NA 6 35 0 0 0 0 FAM172A 83989 broad.mit.edu 37 5 93300198 93300198 + Missense_Mutation SNP C C G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr5:93300198C>G uc010jbd.2 - 5 547 c.340G>C c.(340-342)GAA>CAA p.E114Q FAM172A_uc011cuf.1_Missense_Mutation_p.E68Q|FAM172A_uc011cug.1_Missense_Mutation_p.E68Q|FAM172A_uc011cuh.1_Missense_Mutation_p.E31Q|FAM172A_uc011cui.1_RNA|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Missense_Mutation_p.E114Q NM_032042 NP_114431 Q8WUF8 F172A_HUMAN hypothetical protein LOC83989 isoform 1 114 endoplasmic reticulum|extracellular region 0 CAATCCTTTTCCAGGAGCTCA 0.264 NA 3 19 0 0 0 0 KCNN2 3781 broad.mit.edu 37 5 113798815 113798815 + Silent SNP C C G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr5:113798815C>G uc003kqo.2 + 4 1528 c.1071C>G c.(1069-1071)CTC>CTG p.L357L KCNN2_uc003kqp.2_Silent_p.L9L|KCNN2_uc010jcg.2_RNA|uc003kqq.1_Intron NM_021614 NP_067627 Q9H2S1 KCNN2_HUMAN small conductance calcium-activated potassium 357 integral to membrane calmodulin binding|small conductance calcium-activated potassium channel activity ovary(2) 2 all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206) OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195) TAACTTTTCTCTCCATTGGTT 0.383 NA 30 247 0 0 0 0 MICB 4277 broad.mit.edu 37 6 31477569 31477569 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:31477569C>T uc003ntn.3 + 6 1151 c.1035C>T c.(1033-1035)AGC>AGT p.S345S MICB_uc011dnm.1_Silent_p.S313S|MICB_uc003nto.3_Silent_p.S302S NM_005931 NP_005922 Q29980 MICB_HUMAN MHC class I polypeptide-related sequence B 345 Cytoplasmic (Potential). antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid integral to plasma membrane|MHC class I protein complex natural killer cell lectin-like receptor binding 0 AGCTTGTGAGCCTGCAGGTCC 0.522 NA 32 166 0 0 0 0 ZFAND3 60685 broad.mit.edu 37 6 38084398 38084398 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:38084398G>A uc003onx.2 + 5 827 c.412G>A c.(412-414)GAG>AAG p.E138K NM_021943 NP_068762 Q9H8U3 ZFAN3_HUMAN zinc finger, AN1-type domain 3 138 DNA binding|zinc ion binding ovary(1) 1 ACGACTACTTGAGAATACGGA 0.498 NA 18 116 0 0 0 0 DEFB113 245927 broad.mit.edu 37 6 49937338 49937338 + Missense_Mutation SNP T T C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:49937338T>C uc011dwq.1 - 1 1 c.1A>G c.(1-3)ATG>GTG p.M1V NM_001037729 NP_001032818 Q30KQ7 DB113_HUMAN beta-defensin 113 precursor 1 defense response to bacterium extracellular region 0 Lung NSC(77;0.042) AGTATCTTCATTGCTGATGCA 0.343 NA 16 89 0 0 0 0 KLHL31 401265 broad.mit.edu 37 6 53519101 53519101 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:53519101G>A uc003pcb.3 - 2 1111 c.970C>T c.(970-972)CGC>TGC p.R324C NM_001003760 NP_001003760 Q9H511 KLH31_HUMAN kelch repeat and BTB (POZ) domain containing 1 324 Kelch 1. regulation of transcription, DNA-dependent|transcription, DNA-dependent ovary(1) 1 Lung NSC(77;0.0158) AGGCCTGGGCGTCCCCCAACA 0.478 NA 54 116 0 0 0 0 DST 667 broad.mit.edu 37 6 56426989 56426989 + Missense_Mutation SNP A A G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:56426989A>G uc003pdf.2 - 50 7686 c.7658T>C c.(7657-7659)GTA>GCA p.V2553A DST_uc003pcz.3_Missense_Mutation_p.V2375A|DST_uc011dxj.1_Missense_Mutation_p.V2404A|DST_uc011dxk.1_Missense_Mutation_p.V2415A|DST_uc003pcy.3_Missense_Mutation_p.V2049A NM_001144769 NP_001138241 Q03001 DYST_HUMAN dystonin isoform 2 4461 cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1) 14 Lung NSC(77;0.103) LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956) ACCATTTAATACTGCTCCACC 0.303 NA 2 5 0 0 0 0 OSTM1 28962 broad.mit.edu 37 6 108395463 108395463 + Silent SNP T T A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:108395463T>A uc003psd.2 - 1 479 c.393A>T c.(391-393)CGA>CGT p.R131R NM_014028 NP_054747 Q86WC4 OSTM1_HUMAN osteopetrosis associated transmembrane protein 1 131 Extracellular (Potential). integral to membrane central_nervous_system(1) 1 all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938) BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581) CCCCCGCGGCTCGGCTGATGT 0.597 NA 8 23 0 0 0 0 MICAL1 64780 broad.mit.edu 37 6 109774946 109774946 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:109774946G>A uc003ptj.2 - 2 615 c.361C>T c.(361-363)CGC>TGC p.R121C MICAL1_uc003ptk.2_Missense_Mutation_p.R121C|MICAL1_uc010kdr.2_Missense_Mutation_p.R121C|MICAL1_uc011eaq.1_Missense_Mutation_p.R140C NM_022765 NP_073602 Q8TDZ2 MICA1_HUMAN microtubule associated monoxygenase, calponin 121 cytoskeleton organization|signal transduction cytoplasm|intermediate filament SH3 domain binding|zinc ion binding breast(2)|ovary(1) 3 all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149) Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574) ACGTTGTGGCGAGAGAACTTG 0.662 NA 10 51 0 0 0 0 LAMA2 3908 broad.mit.edu 37 6 129468119 129468119 + Missense_Mutation SNP A A G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:129468119A>G uc003qbn.2 + 6 940 c.835A>G c.(835-837)AAG>GAG p.K279E LAMA2_uc003qbo.2_Missense_Mutation_p.K279E NM_000426 NP_000417 P24043 LAMA2_HUMAN laminin alpha 2 subunit isoform a precursor 279 Laminin N-terminal. cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development laminin-1 complex receptor binding|structural molecule activity ovary(8)|breast(1)|skin(1) 10 OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245) CTACTCGGTCAAGGATATTTC 0.403 NA 31 227 0 0 0 0 LAMA2 3908 broad.mit.edu 37 6 129774131 129774131 + Splice_Site SNP A A C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:129774131A>C uc003qbn.2 + 45 6535 c.6430_splice c.e45-2 p.I2144_splice LAMA2_uc003qbo.2_Splice_Site_p.I2144_splice NM_000426 NP_000417 P24043 LAMA2_HUMAN laminin alpha 2 subunit isoform a precursor cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development laminin-1 complex receptor binding|structural molecule activity ovary(8)|breast(1)|skin(1) 10 OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245) TTTTTTTTAAAGATCAAAGTA 0.343 NA 13 65 0 0 0 0 RAB32 10981 broad.mit.edu 37 6 146865133 146865133 + Missense_Mutation SNP C C G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr6:146865133C>G uc003qln.1 + 1 306 c.126C>G c.(124-126)ATC>ATG p.I42M NM_006834 NP_006825 Q13637 RAB32_HUMAN RAB32, member RAS oncogene family 42 protein transport|small GTPase mediated signal transduction mitochondrion GTP binding 0 Ovarian(120;0.142) OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608) CCAGCATCATCAAGCGCTACG 0.522 NA 13 36 0 0 0 0 DGKB 1607 broad.mit.edu 37 7 14622703 14622703 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr7:14622703G>A uc003ssz.2 - 17 1683 c.1496C>T c.(1495-1497)ACC>ATC p.T499I DGKB_uc011jxt.1_Missense_Mutation_p.T480I|DGKB_uc003sta.2_Missense_Mutation_p.T499I|DGKB_uc011jxu.1_Missense_Mutation_p.T498I NM_004080 NP_004071 Q9Y6T7 DGKB_HUMAN diacylglycerol kinase, beta isoform 1 499 DAGKc. activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation cytoplasm|plasma membrane ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding lung(5)|ovary(4)|breast(2)|skin(1) 12 Phosphatidylserine(DB00144) CCAGCCCACGGTTCCATCTCC 0.398 NA 8 55 0 0 0 0 BAZ1B 9031 broad.mit.edu 37 7 72865288 72865288 + Missense_Mutation SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr7:72865288G>A uc003tyc.2 - 14 3814 c.3469C>T c.(3469-3471)CGG>TGG p.R1157W NM_032408 NP_115784 Q9UIG0 BAZ1B_HUMAN bromodomain adjacent to zinc finger domain, 1B 1157 ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent WINAC complex ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1) 7 Lung NSC(55;0.0659)|all_lung(88;0.152) TGAGCTTCCCGGATTGCTGTC 0.488 NA 31 114 0 0 0 0 SEMA3E 9723 broad.mit.edu 37 7 83014715 83014715 + Silent SNP A A T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr7:83014715A>T uc003uhy.1 - 16 2236 c.1770T>A c.(1768-1770)GCT>GCA p.A590A NM_012431 NP_036563 O15041 SEM3E_HUMAN semaphorin 3E precursor 590 Ig-like C2-type. axon guidance extracellular space|membrane receptor activity ovary(3) 3 Medulloblastoma(109;0.109) CTATGCCATAAGCCAGATGTT 0.373 NA 29 281 0 0 0 0 PARP12 64761 broad.mit.edu 37 7 139741627 139741627 + Silent SNP A A G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr7:139741627A>G uc003vvl.1 - 6 1873 c.999T>C c.(997-999)TCT>TCC p.S333S PARP12_uc003vvk.1_Silent_p.S119S|PARP12_uc010lnf.1_RNA NM_022750 NP_073587 Q9H0J9 PAR12_HUMAN poly ADP-ribose polymerase 12 333 WWE 1. nucleus NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding ovary(3) 3 Melanoma(164;0.0142) TGGCTGACTCAGAGCACAGGA 0.527 NA 56 111 0 0 0 0 CSMD3 114788 broad.mit.edu 37 8 113812428 113812428 + Missense_Mutation SNP T T A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr8:113812428T>A uc003ynu.2 - 13 2094 c.1935A>T c.(1933-1935)GAA>GAT p.E645D CSMD3_uc003ynt.2_Missense_Mutation_p.E605D|CSMD3_uc011lhx.1_Missense_Mutation_p.E541D NM_198123 NP_937756 Q7Z407 CSMD3_HUMAN CUB and Sushi multiple domains 3 isoform 1 645 Extracellular (Potential).|CUB 3. integral to membrane|plasma membrane ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1) 63 ATCCAACACTTTCGTCCGTTT 0.378 NA HNSCC(6;0.00088)|TCGA Ovarian(7;0.080) 37 90 0 0 0 0 KCNV2 169522 broad.mit.edu 37 9 2717793 2717793 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr9:2717793G>A uc003zho.1 + 1 268 c.54G>A c.(52-54)ACG>ACA p.T18T NM_133497 NP_598004 Q8TDN2 KCNV2_HUMAN potassium channel, subfamily V, member 2 18 Cytoplasmic (Potential). voltage-gated potassium channel complex voltage-gated potassium channel activity ovary(1)|central_nervous_system(1) 2 GBM - Glioblastoma multiforme(50;0.0257) CCTGGAACACGACGGAGAATG 0.607 NA 74 158 0 0 0 0 ORM1 5004 broad.mit.edu 37 9 117087155 117087155 + Missense_Mutation SNP G G C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr9:117087155G>C uc004bik.3 + 4 525 c.414G>C c.(412-414)AAG>AAC p.K138N ORM1_uc011lxo.1_Missense_Mutation_p.K138N NM_000607 NP_000598 P02763 A1AG1_HUMAN orosomucoid 1 precursor 138 acute-phase response|regulation of immune system process|transport extracellular space protein binding 0 Myeloproliferative disorder(63;0.163) Acenocoumarol(DB01418)|Alfentanil(DB00802)|Aprindine(DB01429)|Disopyramide(DB00280)|Penbutolol(DB01359)|Phenprocoumon(DB00946)|Quinidine(DB00908)|Tamsulosin(DB00706) ACGATGAGAAGAACTGGGGGC 0.567 NA 10 73 0 0 0 0 TLR4 7099 broad.mit.edu 37 9 120470945 120470945 + Silent SNP G G A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr9:120470945G>A uc004bjz.2 + 2 489 c.198G>A c.(196-198)CTG>CTA p.L66L TLR4_uc004bka.2_Silent_p.L26L|TLR4_uc004bkb.2_Intron NM_138554 NP_612564 O00206 TLR4_HUMAN toll-like receptor 4 precursor 66 LRR 1.|Extracellular (Potential). activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm lipopolysaccharide receptor activity|transmembrane receptor activity lung(10)|ovary(4)|breast(1)|skin(1) 16 TTAATCCCCTGAGGCATTTAG 0.438 NA 29 212 0 0 0 0 PHF19 26147 broad.mit.edu 37 9 123629194 123629194 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr9:123629194C>T uc004bks.1 - 7 917 c.664G>A c.(664-666)GAG>AAG p.E222K PHF19_uc011lyf.1_Missense_Mutation_p.E13K|PHF19_uc004bkr.2_RNA NM_015651 NP_056466 Q5T6S3 PHF19_HUMAN PHD finger protein 19 isoform a 222 PHD-type 2. regulation of transcription, DNA-dependent|transcription, DNA-dependent nucleus nucleic acid binding|zinc ion binding ovary(1)|breast(1) 2 GTGCAGGCCTCGTGGAACCAC 0.607 NA 18 92 0 0 0 0 GOLGA1 2800 broad.mit.edu 37 9 127685430 127685430 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr9:127685430C>T uc004bpc.2 - 8 847 c.505G>A c.(505-507)GAA>AAA p.E169K GOLGA1_uc010mws.2_RNA|GOLGA1_uc010mwt.1_Missense_Mutation_p.E144K NM_002077 NP_002068 Q92805 GOGA1_HUMAN golgin 97 169 Potential. Golgi cisterna membrane ovary(1) 1 TCATCCATTTCATCTCTCCTT 0.348 NA 34 182 0 0 0 0 SNAPC4 6621 broad.mit.edu 37 9 139272877 139272877 + Missense_Mutation SNP C C A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr9:139272877C>A uc004chh.2 - 21 3411 c.3402G>T c.(3400-3402)TGG>TGT p.W1134C NM_003086 NP_003077 Q5SXM2 SNPC4_HUMAN small nuclear RNA activating complex, 1134 Pro-rich. snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter snRNA-activating protein complex DNA binding|sequence-specific DNA binding transcription factor activity 0 Myeloproliferative disorder(178;0.0511) OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06) CTGGGGGCTGCCAAGAGCTGC 0.687 NA 5 17 5.94e-07 6.6e-07 1 0 IL1RAPL1 11141 broad.mit.edu 37 X 29938080 29938080 + Missense_Mutation SNP A A G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chrX:29938080A>G uc004dby.2 + 8 1434 c.926A>G c.(925-927)CAT>CGT p.H309R NM_014271 NP_055086 Q9NZN1 IRPL1_HUMAN interleukin 1 receptor accessory protein-like 1 309 Extracellular (Potential).|Ig-like C2-type 3. innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development cytoplasm|integral to membrane|plasma membrane protein binding|transmembrane receptor activity ovary(3)|lung(1)|pancreas(1) 5 CTTAAGGAGCATCTTGGGGAA 0.363 NA 42 107 0 0 0 0 TEX11 56159 broad.mit.edu 37 X 69749731 69749731 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chrX:69749731C>T uc004dyl.2 - 30 2846 c.2684G>A c.(2683-2685)CGT>CAT p.R895H TEX11_uc004dyk.2_Missense_Mutation_p.R570H|TEX11_uc004dym.2_Missense_Mutation_p.R880H NM_001003811 NP_001003811 Q8IYF3 TEX11_HUMAN testis expressed sequence 11 isoform 1 895 protein binding ovary(3)|breast(1)|skin(1) 5 Renal(35;0.156) GTTAAGGAAACGCAAGGCCAG 0.498 NA 7 59 0 0 0 0 TCEAL5 340543 broad.mit.edu 37 X 102528984 102528984 + Missense_Mutation SNP A A C TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chrX:102528984A>C uc004ejz.1 - 3 803 c.508T>G c.(508-510)TGG>GGG p.W170G NM_001012979 NP_001012997 Q5H9L2 TCAL5_HUMAN transcription elongation factor A (SII)-like 5 170 regulation of transcription, DNA-dependent|transcription, DNA-dependent nucleus protein binding lung(1)|breast(1) 2 CTTTGCATCCAATGAAAACCA 0.512 NA 43 106 0 0 0 0 MID2 11043 broad.mit.edu 37 X 107170195 107170195 + Silent SNP C C A TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chrX:107170195C>A uc004enl.2 + 10 2673 c.2100C>A c.(2098-2100)ATC>ATA p.I700I MID2_uc004enk.2_Silent_p.I670I NM_012216 NP_036348 Q9UJV3 TRIM1_HUMAN midline 2 isoform 1 700 B30.2/SPRY. centrosome|microtubule ligase activity|zinc ion binding ovary(1) 1 CCCTAATGATCCTGTCTGGCT 0.443 NA 36 94 9.73e-26 1.15e-25 1 0 LUZP4 51213 broad.mit.edu 37 X 114536558 114536558 + Silent SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chrX:114536558C>T uc004eqa.2 + 2 127 c.93C>T c.(91-93)GAC>GAT p.D31D LUZP4_uc004eqb.2_Translation_Start_Site NM_016383 NP_057467 Q9P127 LUZP4_HUMAN leucine zipper protein 4 31 nucleus p.D31Y(1) ovary(2) 2 CTAATACAGACGACATTATAA 0.299 NA 17 36 0 0 0 0 MAP7D3 79649 broad.mit.edu 37 X 135314215 135314215 + Missense_Mutation SNP C C T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chrX:135314215C>T uc004ezt.2 - 8 992 c.901G>A c.(901-903)GCA>ACA p.A301T MAP7D3_uc004ezs.2_Missense_Mutation_p.A265T|MAP7D3_uc011mwc.1_Missense_Mutation_p.A283T|MAP7D3_uc010nsa.1_Missense_Mutation_p.A259T NM_024597 NP_078873 Q8IWC1 MA7D3_HUMAN MAP7 domain containing 3 301 cytoplasm|spindle ovary(2)|central_nervous_system(1)|skin(1) 4 Acute lymphoblastic leukemia(192;0.000127) TCCACACTTGCCTTGGGAGGT 0.517 NA 72 239 0 0 0 0 CACNA1E 777 broad.mit.edu 37 1 181680102 181680103 + Frame_Shift_Del DEL AG AG - TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr1:181680102_181680103delAG uc001gow.2 + 8 1233_1234 c.1068_1069delAG c.(1066-1071)AAAGAGfs p.K356fs CACNA1E_uc009wxs.2_Frame_Shift_Del_p.K263fs NM_000721 NP_000712 Q15878 CAC1E_HUMAN calcium channel, voltage-dependent, R type, 356_357 Cytoplasmic (Potential). energy reserve metabolic process|membrane depolarization|synaptic transmission voltage-gated calcium channel complex voltage-gated calcium channel activity ovary(3)|central_nervous_system(2)|pancreas(1) 6 AATTTGCCAAAGAGAGAGAGAG 0.51 NA 8 157 --- --- --- --- NA NA NA NA JUB 84962 broad.mit.edu 37 14 23451267 23451268 + Frame_Shift_Ins INS - - G TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr14:23451267_23451268insG uc001whz.2 - 1 584_585 c.208_209insC c.(208-210)CTGfs p.L70fs NM_032876 NP_116265 Q96IF1 JUB_HUMAN ajuba isoform 1 70 PreLIM. cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center alpha-catenin binding|zinc ion binding 0 all_cancers(95;4.6e-05) GBM - Glioblastoma multiforme(265;0.0122) CTCAGCGTCCAGGGAACCTTGC 0.693 NA 12 14 --- --- --- --- NA NA NA NA LINS1 55180 broad.mit.edu 37 15 101120736 101120737 + Frame_Shift_Ins INS - - AATA rs61741890 byFrequency TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr15:101120736_101120737insAATA uc002bwe.2 - 3 602_603 c.311_312insTATT c.(310-312)TTGfs p.L104fs LINS1_uc002bwf.2_Frame_Shift_Ins_p.L104fs|LINS1_uc002bwg.2_Frame_Shift_Ins_p.L104fs|LINS1_uc002bwh.2_Frame_Shift_Ins_p.L104fs|LINS1_uc010usa.1_Intron|LINS1_uc002bwi.2_Frame_Shift_Ins_p.L104fs NM_001040614 NP_001035704 Q8NG48 LINES_HUMAN lines homolog 1 104 0 Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852) OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103) TTTTGACAGACAATATCCGGGT 0.406 NA 12 122 --- --- --- --- NA NA NA NA CEP97 79598 broad.mit.edu 37 3 101476041 101476042 + Splice_Site INS - - T TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr3:101476041_101476042insT uc003dvk.1 + 8 1054 c.1027_splice c.e8+1 p.E343_splice CEP97_uc010hpm.1_Splice_Site_p.E309_splice|CEP97_uc011bhf.1_Splice_Site_p.E343_splice|CEP97_uc003dvl.1_Splice_Site_p.E39_splice|CEP97_uc003dvm.1_Splice_Site_p.E181_splice NM_024548 NP_078824 Q8IW35 CEP97_HUMAN centrosomal protein 97kDa centrosome|nucleus protein binding ovary(2) 2 CAGGAAAGTGGTAAGAAATGAA 0.371 NA 33 200 --- --- --- --- NA NA NA NA DOLK 22845 broad.mit.edu 37 9 131708357 131708357 + Frame_Shift_Del DEL A A - TCGA-CV-5431-01A-01D-1512-08 TCGA-CV-5431-11A-01D-1512-08 Unknown Untested Somatic Unspecified WXS none NA NA Illumina HiSeq f1a234f0-8890-4cf3-891f-c7a7423b1e75 9fd15bac-b77c-4246-b8d7-895e9cd0e4d3 g.chr9:131708357delA uc004bwr.2 - 1 1656 c.1226delT c.(1225-1227)ATCfs p.I409fs NUP188_uc004bws.1_5'Flank|NUP188_uc004bwq.1_Intron NM_014908 NP_055723 Q9UPQ8 DOLK_HUMAN dolichol kinase 409 Helical; (Potential). dolichyl diphosphate biosynthetic process|dolichyl monophosphate biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine integral to endoplasmic reticulum membrane|membrane fraction dolichol kinase activity 0 GAGCAGGTAGATGTGTGTCAG 0.577 NA 20 91 --- --- --- --- NA NA NA NA