Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
RHCE	6006	broad.mit.edu	37	1	25718526	25718526	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:25718526T>C	uc001bkf.2	-	4	679	c.593A>G	c.(592-594)AAT>AGT	p.N198S	RHCE_uc001bkg.2_Missense_Mutation_p.N198S|RHCE_uc001bkh.2_Intron|RHCE_uc001bki.2_Intron|RHCE_uc001bkj.2_Missense_Mutation_p.N182S	NM_020485	NP_065231	P18577	RHCE_HUMAN	Rhesus blood group, CcEe antigens isoform 1	198						integral to plasma membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCTGATCATTATCCTCCGT	0.527			NA											5	102					0	0	0.014758	0	0
SMG5	23381	broad.mit.edu	37	1	156247793	156247793	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:156247793A>G	uc001foc.3	-	3	369	c.220T>C	c.(220-222)TAT>CAT	p.Y74H		NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay	74					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					TTTCTCCCATAGTCCACTGGG	0.502			NA											6	67					0	0	0.021553	0	0
SPTA1	6708	broad.mit.edu	37	1	158631122	158631122	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:158631122G>A	uc001fst.1	-	18	2741	c.2542C>T	c.(2542-2544)CGC>TGC	p.R848C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	848	Spectrin 9.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCTTGAATGCGTGGTTCATGG	0.438			NA											9	89					0	0	0.047766	0	0
SLC26A9	115019	broad.mit.edu	37	1	205904909	205904909	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr1:205904909C>T	uc001hdq.2	-	2	154	c.40G>A	c.(40-42)GCA>ACA	p.A14T	SLC26A9_uc001hdp.2_Missense_Mutation_p.A14T	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a	14						integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AGGGAGTATGCGGCTCTGTCT	0.557			NA											5	72					0	0	0.021553	0	0
OGDHL	55753	broad.mit.edu	37	10	50964886	50964886	+	Missense_Mutation	SNP	C	C	T	rs145127820	by1000genomes	TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr10:50964886C>T	uc001jie.2	-	3	453	c.311G>A	c.(310-312)CGG>CAG	p.R104Q	OGDHL_uc009xog.2_Missense_Mutation_p.R131Q|OGDHL_uc010qgt.1_Intron|OGDHL_uc010qgu.1_Intron|OGDHL_uc009xoh.2_5'UTR	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	104					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						GGTCTTGGTCCGACTTGAGAC	0.612			NA											8	57					0	0	0.058154	0	0
UNC5B	219699	broad.mit.edu	37	10	73047465	73047465	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr10:73047465G>A	uc001jro.2	+	6	1289	c.844G>A	c.(844-846)GGG>AGG	p.G282R	UNC5B_uc001jrp.2_Missense_Mutation_p.G282R	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B precursor	282	TSP type-1 1.|Extracellular (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3						ACTCAACGGAGGGGCCTTCTG	0.667			NA											5	66					0	0	0.014758	0	0
C10orf12	26148	broad.mit.edu	37	10	98711952	98711952	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr10:98711952G>C	uc009xvg.1	+	7	852	c.331G>C	c.(331-333)GGT>CGT	p.G111R	LCOR_uc001kmr.2_Missense_Mutation_p.G111R|LCOR_uc001kms.1_Missense_Mutation_p.G111R|LCOR_uc001kmt.1_Missense_Mutation_p.G111R|LCOR_uc001kmu.1_Missense_Mutation_p.G111R	NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TCAAGGGAACGGGTAAGGGAG	0.438			NA											6	66					0	0	0.02938	0	0
OR4C13	283092	broad.mit.edu	37	11	49974551	49974551	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:49974551C>T	uc010rhz.1	+	1	577	c.577C>T	c.(577-579)CTA>TTA	p.L193L		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						TACCCACACTCTAGGACTCTT	0.438			NA											16	98					0	0	0.024245	0	0
MTA2	9219	broad.mit.edu	37	11	62362837	62362837	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:62362837A>G	uc001ntq.1	-	14	1763	c.1382T>C	c.(1381-1383)CTG>CCG	p.L461P	MTA2_uc010rlx.1_Missense_Mutation_p.L288P	NM_004739	NP_004730	O94776	MTA2_HUMAN	metastasis-associated protein 2	461					chromatin assembly or disassembly	NuRD complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						AAGACGGGTCAGCTTTGTGGT	0.537			NA											12	99					0	0	0.080935	0	0
PYGM	5837	broad.mit.edu	37	11	64521112	64521112	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:64521112G>A	uc001oax.3	-	11	2099	c.1282C>T	c.(1282-1284)CGC>TGC	p.R428C	PYGM_uc001oay.3_Missense_Mutation_p.R340C	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	428					glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	AGCGACATGCGCCGCAGCCGG	0.687			NA											4	14					0	0	0.014758	0	0
TSGA10IP	254187	broad.mit.edu	37	11	65714930	65714930	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr11:65714930G>A	uc001ogk.1	+	5	666	c.634G>A	c.(634-636)GAC>AAC	p.D212N	TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_Intron	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	212											0						ATCGGCGTCCGACAAGCAGGT	0.662			NA											5	31					0	0	0.021553	0	0
KIAA0748	9840	broad.mit.edu	37	12	55368298	55368298	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr12:55368298A>G	uc001sgn.3	-	2	159	c.49T>C	c.(49-51)TGG>CGG	p.W17R	KIAA0748_uc001sgl.3_5'Flank|KIAA0748_uc001sgm.3_5'Flank|KIAA0748_uc010spb.1_5'Flank|KIAA0748_uc010spc.1_5'Flank|KIAA0748_uc010spd.1_Missense_Mutation_p.W17R|KIAA0748_uc001sgo.3_RNA	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840	17										ovary(1)|central_nervous_system(1)	2						TGACGGAGCCAGGCCCGCCGT	0.632			NA											4	9					0	0	0.009096	0	0
NAV3	89795	broad.mit.edu	37	12	78513568	78513568	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr12:78513568G>T	uc001syp.2	+	15	3765	c.3592G>T	c.(3592-3594)GAC>TAC	p.D1198Y	NAV3_uc001syo.2_Missense_Mutation_p.D1198Y|NAV3_uc010sub.1_Missense_Mutation_p.D698Y|NAV3_uc009zsf.2_Missense_Mutation_p.D206Y	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1198	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CAACCAAACAGACAAGGAAAA	0.527			NA								HNSCC(70;0.22)			6	58					0.00116845	0.00154323	0.021553	1	0
C12orf51	283450	broad.mit.edu	37	12	112600844	112600844	+	Splice_Site	SNP	A	A	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr12:112600844A>C	uc009zwc.2	-	68	11872	c.11854_splice	c.e68+1	p.G3952_splice		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						GGAGGGCGGTACCTGCTGTGC	0.617			NA											5	87					0	0	0.021553	0	0
RHOT2	89941	broad.mit.edu	37	16	721945	721945	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:721945G>C	uc002cip.2	+	13	1107	c.1040G>C	c.(1039-1041)CGC>CCC	p.R347P	RHOT2_uc002ciq.2_Missense_Mutation_p.R240P|RHOT2_uc010bqy.2_Missense_Mutation_p.R126P	NM_138769	NP_620124	Q8IXI1	MIRO2_HUMAN	ras homolog gene family, member T2	347	Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			pancreas(1)	1		Hepatocellular(780;0.0218)				GAGCTCCCACGCACAGTCCGC	0.697			NA											8	84					0	0	0.038147	0	0
ZNF200	7752	broad.mit.edu	37	16	3274335	3274335	+	Silent	SNP	T	T	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:3274335T>G	uc002cuj.2	-	5	1377	c.745A>C	c.(745-747)AGG>CGG	p.R249R	ZNF200_uc002cum.3_Silent_p.R248R|ZNF200_uc010bti.2_Silent_p.R248R|ZNF200_uc002cuk.2_Silent_p.R249R|ZNF200_uc002cui.2_Silent_p.R248R|ZNF200_uc002cul.3_Silent_p.R248R	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	249					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						TACCATCTCCTTGTCCTCCGA	0.418			NA											7	65					0	0	0.02938	0	0
ADCY9	115	broad.mit.edu	37	16	4165247	4165247	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:4165247C>T	uc002cvx.2	-	2	736	c.197G>A	c.(196-198)CGA>CAA	p.R66Q		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	66	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						GCCGCCCACTCGCCGGGGGAC	0.667			NA											5	26					0	0	0.014758	0	0
SLC12A3	6559	broad.mit.edu	37	16	56904081	56904081	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr16:56904081C>T	uc010ccm.2	+	5	704	c.675C>T	c.(673-675)TTC>TTT	p.F225F	SLC12A3_uc002ekd.3_Silent_p.F225F|SLC12A3_uc010ccn.2_Silent_p.F224F	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	225	Helical; (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TTTTCGCTTTCGCCAATGCCG	0.647			NA											6	87					0	0	0.02938	0	0
SUPT6H	6830	broad.mit.edu	37	17	27003436	27003436	+	Silent	SNP	T	T	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr17:27003436T>G	uc002hby.2	+	7	975	c.885T>G	c.(883-885)CCT>CCG	p.P295P	SUPT6H_uc010crt.2_Silent_p.P295P	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	295					chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					CTGACCTGCCTGAGAGGTTCC	0.463			NA											5	71					0	0	0.021553	0	0
RAB11FIP4	84440	broad.mit.edu	37	17	29848989	29848989	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr17:29848989T>A	uc002hgn.1	+	6	1044	c.815T>A	c.(814-816)GTT>GAT	p.V272D	RAB11FIP4_uc002hgo.2_Missense_Mutation_p.V170D	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	272	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				TTGCTAGATGTTTACTGCTCT	0.522			NA											9	62					0	0	0.047766	0	0
EPB41L3	23136	broad.mit.edu	37	18	5433980	5433980	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr18:5433980T>C	uc002kmt.1	-	7	832	c.746A>G	c.(745-747)TAC>TGC	p.Y249C	EPB41L3_uc010wzh.1_Missense_Mutation_p.Y249C|EPB41L3_uc002kmu.1_Missense_Mutation_p.Y249C|EPB41L3_uc010dkq.1_Missense_Mutation_p.Y140C|EPB41L3_uc010dks.1_Missense_Mutation_p.Y271C|EPB41L3_uc002kmv.1_Missense_Mutation_p.Y140C	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	249	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CTCACTAATGTAATCGCTCCC	0.517			NA											13	119					0	0	0.028581	0	0
ROCK1	6093	broad.mit.edu	37	18	18650556	18650556	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr18:18650556C>A	uc002kte.2	-	2	1053	c.112G>T	c.(112-114)GTA>TTA	p.V38L		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	38					actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					AAATCATATACCAAAGCATCC	0.294			NA											4	19					0.000602214	0.000810673	0.014758	1	0
DIRAS1	148252	broad.mit.edu	37	19	2717373	2717373	+	Silent	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:2717373G>A	uc002lwf.3	-	2	590	c.432C>T	c.(430-432)TGC>TGT	p.C144C		NM_145173	NP_660156	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	144					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCATGAAAGCGCACTTCCACT	0.622			NA											13	90					0	0	0.105934	0	0
MUC16	94025	broad.mit.edu	37	19	9008336	9008336	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:9008336C>T	uc002mkp.2	-	41	39420	c.39216G>A	c.(39214-39216)AAG>AAA	p.K13072K	MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13074	Extracellular (Potential).|SEA 7.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTGCCCCATCCTTCTCAGACC	0.557			NA											12	123					0	0	0.080935	0	0
RYR1	6261	broad.mit.edu	37	19	38933075	38933075	+	Silent	SNP	G	G	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:38933075G>C	uc002oit.2	+	3	382	c.252G>C	c.(250-252)ACG>ACC	p.T84T	RYR1_uc002oiu.2_Silent_p.T84T	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	84	Cytoplasmic.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TGGCTAACACGGTGGAGGCTG	0.667			NA											4	54					0	0	0.009096	0	0
RYR1	6261	broad.mit.edu	37	19	38976776	38976776	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:38976776C>T	uc002oit.2	+	34	5611	c.5481C>T	c.(5479-5481)CGC>CGT	p.R1827R	RYR1_uc002oiu.2_Silent_p.R1827R	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1827	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	p.R1827H(1)		ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AGCACGCTCGCGACCCCGTCG	0.682			NA											24	154					0	0	0.069288	0	0
PLA2G4C	8605	broad.mit.edu	37	19	48558162	48558162	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:48558162G>A	uc002phx.2	-	15	1800	c.1402C>T	c.(1402-1404)CCC>TCC	p.P468S	PLA2G4C_uc002phv.2_RNA|PLA2G4C_uc002phw.2_Missense_Mutation_p.P403S|PLA2G4C_uc010elr.2_Missense_Mutation_p.P468S|PLA2G4C_uc010xzd.1_Missense_Mutation_p.P478S	NM_003706	NP_003697	Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC isoform 1 precursor	468	PLA2c.				arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding			ovary(1)|skin(1)	2		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		TTGAACAGGGGAAAATGCATC	0.448			NA											10	83					0	0	0.069234	0	0
AP2A1	160	broad.mit.edu	37	19	50306626	50306626	+	Silent	SNP	C	C	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:50306626C>G	uc002ppn.2	+	19	2614	c.2403C>G	c.(2401-2403)CTC>CTG	p.L801L	AP2A1_uc010enj.1_RNA|AP2A1_uc002ppo.2_Silent_p.L779L|AP2A1_uc002ppp.1_3'UTR|AP2A1_uc010enk.2_5'Flank	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1	801					axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CGGGAGACCTCCAGACTCATA	0.607			NA											6	24					0	0	0.038147	0	0
NLRP13	126204	broad.mit.edu	37	19	56443372	56443372	+	Silent	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr19:56443372T>C	uc010ygg.1	-	1	331	c.306A>G	c.(304-306)AGA>AGG	p.R102R		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	102	DAPIN.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TCATCTCGGCTCTAACTTTCT	0.517			NA											8	33					0	0	0.047766	0	0
ST6GAL2	84620	broad.mit.edu	37	2	107423242	107423242	+	Silent	SNP	G	G	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr2:107423242G>T	uc002tdq.2	-	6	1601	c.1482C>A	c.(1480-1482)CGC>CGA	p.R494R	ST6GAL2_uc002tdr.2_Silent_p.R494R	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	494	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						CCATGTTCAGGCGCTGCACCA	0.622			NA											7	84					8.12818e-05	0.000113795	0.02938	1	0
SCN3A	6328	broad.mit.edu	37	2	165984435	165984435	+	Silent	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr2:165984435C>T	uc002ucx.2	-	18	3591	c.3099G>A	c.(3097-3099)AAG>AAA	p.K1033K	SCN3A_uc002ucy.2_Silent_p.K984K|SCN3A_uc002ucz.2_Silent_p.K984K|SCN3A_uc002uda.1_Silent_p.K853K|SCN3A_uc002udb.1_Silent_p.K853K	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1033						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	TAACTTTTGGCTTTCTAAAAA	0.333			NA											4	60					0	0	0.009096	0	0
TTN	7273	broad.mit.edu	37	2	179397281	179397281	+	Silent	SNP	A	A	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr2:179397281A>T	uc010zfg.1	-	307	96581	c.96357T>A	c.(96355-96357)CTT>CTA	p.L32119L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L25814L|TTN_uc010zfi.1_Silent_p.L25747L|TTN_uc010zfj.1_Silent_p.L25622L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33046							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACCTAACTCAAGCTCTTCTT	0.473			NA											10	91					0	0	0.058154	0	0
SAMHD1	25939	broad.mit.edu	37	20	35533856	35533856	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr20:35533856C>T	uc002xgh.1	-	12	1451	c.1321G>A	c.(1321-1323)GCA>ACA	p.A441T	SAMHD1_uc010gft.1_RNA	NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	441					defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				ATCTCTCGTGCGTCTTTCAAT	0.318			NA											6	61					0	0	0.021553	0	0
KRTAP24-1	643803	broad.mit.edu	37	21	31655071	31655071	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr21:31655071G>T	uc002ynv.2	-	1	206	c.180C>A	c.(178-180)TAC>TAA	p.Y60*		NM_001085455	NP_001078924	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	60						keratin filament	structural molecule activity				0						ATTCTTGGCAGTAATCCAGGA	0.512			NA											7	82					5.68852e-11	8.29577e-11	0.047766	1	0
SEC14L3	266629	broad.mit.edu	37	22	30864641	30864641	+	Missense_Mutation	SNP	G	G	A	rs116683933	by1000genomes	TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr22:30864641G>A	uc003ahy.2	-	5	366	c.277C>T	c.(277-279)CGT>TGT	p.R93C	SEC14L3_uc003ahz.2_Missense_Mutation_p.R16C|SEC14L3_uc003aia.2_Missense_Mutation_p.R34C|SEC14L3_uc003aib.2_Missense_Mutation_p.R34C	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	93	CRAL-TRIO.					integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	CAGCCATCACGGTCATAGCCA	0.547	Esophageal Squamous(108;290 1516 3584 23771 37333)		NA											6	105					0	0	0.02938	0	0
CGGBP1	8545	broad.mit.edu	37	3	88105073	88105073	+	Silent	SNP	A	A	G			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr3:88105073A>G	uc003dqs.2	-	4	566	c.54T>C	c.(52-54)GCT>GCC	p.A18A	CGGBP1_uc003dqt.2_Silent_p.A18A|CGGBP1_uc003dqu.2_Silent_p.A18A	NM_001008390	NP_001008391	Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1	18					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding				0		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		TCACATACAAAGCAGTCTTAG	0.428			NA											4	78					0	0	0.014758	0	0
GDF9	2661	broad.mit.edu	37	5	132199850	132199850	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr5:132199850C>T	uc003kxz.1	-	1	628	c.376G>A	c.(376-378)GCT>ACT	p.A126T	GDF9_uc011cxj.1_Missense_Mutation_p.A38T|UQCRQ_uc003kya.1_5'Flank	NM_005260	NP_005251	O60383	GDF9_HUMAN	growth differentiation factor 9 precursor	126					female gamete generation|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			skin(1)	1		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTCCAGGAGCCTGCTTGTGC	0.468			NA											11	83					0	0	0.09319	0	0
HDAC9	9734	broad.mit.edu	37	7	18767353	18767353	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr7:18767353C>T	uc003suh.2	+	12	1914	c.1873C>T	c.(1873-1875)CGC>TGC	p.R625C	HDAC9_uc003sue.2_Missense_Mutation_p.R625C|HDAC9_uc011jyd.1_Missense_Mutation_p.R625C|HDAC9_uc003sui.2_Missense_Mutation_p.R628C|HDAC9_uc003suj.2_Missense_Mutation_p.R584C|HDAC9_uc003sua.1_Missense_Mutation_p.R603C|HDAC9_uc010kue.1_Missense_Mutation_p.R280C	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	625					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	AGCAATGGACCGCCCCCTCCA	0.527			NA											3	18					0	0	0.009096	0	0
ERI1	90459	broad.mit.edu	37	8	8877863	8877863	+	Silent	SNP	T	T	C			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr8:8877863T>C	uc011kwu.1	+	6	956	c.696T>C	c.(694-696)TCT>TCC	p.S232S	ERI1_uc003wsk.2_Silent_p.S232S	NM_153332	NP_699163	Q8IV48	ERI1_HUMAN	three prime histone mRNA exonuclease 1	232	Exonuclease.				gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)	TTTATAGTTCTTGGGATATGA	0.303			NA											2	14					0	0	0.004672	0	0
TMEM67	91147	broad.mit.edu	37	8	94767313	94767313	+	Silent	SNP	C	C	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr8:94767313C>A	uc011lgk.1	+	1	242	c.171C>A	c.(169-171)ATC>ATA	p.I57I	TMEM67_uc010mau.2_Silent_p.I57I|TMEM67_uc010mav.2_Silent_p.I57I|TMEM67_uc010mat.1_5'UTR|TMEM67_uc010maw.2_Silent_p.I57I|TMEM67_uc003yga.3_5'UTR	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	57					cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ACTTTGATATCTCCGCCCTCT	0.552			NA											14	125					0.000219431	0.00030118	0.020292	1	0
CXorf59	286464	broad.mit.edu	37	X	36117961	36117961	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chrX:36117961C>T	uc004ddk.1	+	7	1003	c.817C>T	c.(817-819)CGG>TGG	p.R273W		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	273						integral to membrane				central_nervous_system(1)	1						CTGGAGTAAACGGGCATGGAC	0.333			NA											5	18					0	0	0.021553	0	0
MED12	9968	broad.mit.edu	37	X	70343061	70343061	+	Silent	SNP	G	G	A			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chrX:70343061G>A	uc004dyy.2	+	11	1801	c.1602G>A	c.(1600-1602)GCG>GCA	p.A534A	MED12_uc011mpq.1_Silent_p.A534A|MED12_uc004dyz.2_Silent_p.A534A|MED12_uc004dza.2_Silent_p.A381A	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	534					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					AGAGACAGGCGGAGATTGAGG	0.532			NA											5	21					0	0	0.021553	0	0
SEC22A	26984	broad.mit.edu	37	3	122990411	122990412	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr3:122990411_122990412delTC	uc003ege.2	+	7	845_846	c.766_767delTC	c.(766-768)TCTfs	p.S256fs	SEC22A_uc003egf.2_Frame_Shift_Del_p.S256fs	NM_012430	NP_036562	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A	256	Helical; (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0548)		GAATGTCAAATCTTTTTTGACT	0.371			NA											9	72	---	---	---	---	NA	NA	NA	NA	NA
ZNF746	155061	broad.mit.edu	37	7	149174059	149174059	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7552-01A-11D-2036-08	TCGA-97-7552-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	c2747b2f-b56d-4aac-9f62-57dc5bfc7a55	e76af5cd-3b21-4a74-90f1-98d5f09b5496	g.chr7:149174059delT	uc003wfw.2	-	6	1063	c.792delA	c.(790-792)GCAfs	p.A264fs	ZNF746_uc010lpi.2_Frame_Shift_Del_p.A264fs	NM_152557	NP_689770	Q6NUN9	ZN746_HUMAN	zinc finger protein 746 isoform 2	264					negative regulation of transcription, DNA-dependent|neuron death|regulation of cell death|transcription, DNA-dependent	cytoplasm|nucleus	transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding			ovary(2)|breast(1)	3	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			CGTCCGAGCATGCTGAAGAGG	0.612			NA											16	115	---	---	---	---	NA	NA	NA	NA	NA